99
|
STATA Corporation
stata 17 statacorp Stata 17 Statacorp, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+1%2E0/ppr0598942-280-13-15 Average 99 stars, based on 1 article reviews
stata 17 statacorp - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
version 15 0 Version 15 0, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+15%2E0/pmc10358222-190-6-8 Average 99 stars, based on 1 article reviews
version 15 0 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
version 12 Version 12, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+12%2E0/pmc07326073-210-16-21 Average 99 stars, based on 1 article reviews
version 12 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
r version 3 3 3 R Version 3 3 3, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+3%2E0/pmc07758928-111-19-23 Average 99 stars, based on 1 article reviews
r version 3 3 3 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
statistical software release 16 Statistical Software Release 16, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+16%2E0/pmc07758928-111-24-23 Average 99 stars, based on 1 article reviews
statistical software release 16 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
SYSTAT
sigmaplot Sigmaplot, supplied by SYSTAT, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/SigmaPlot+v14%2E0/pmc08863875-81-13-15 Average 99 stars, based on 1 article reviews
sigmaplot - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
Olympus
microscope bx61wi Microscope Bx61wi, supplied by Olympus, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/BX61WI%2FBX51WI+Fixed+Stage+Microscope/10__1007_slash_978___1___4939___0381___8-2847-31-38 Average 99 stars, based on 1 article reviews
microscope bx61wi - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
90
|
Promega
fugene® hd transfection reagent Fugene® Hd Transfection Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/fugene+hd/pmc07334594__mmc1-46-173-177 Average 90 stars, based on 1 article reviews
fugene® hd transfection reagent - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
97
|
OriGene
2018 n a ifi44l reverse primer 2018 N A Ifi44l Reverse Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/Primer/pmc07953434__mmc7-210-120-141 Average 97 stars, based on 1 article reviews
2018 n a ifi44l reverse primer - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
90
|
OriGene
time rt pcr ggcaaagaggtccaagatgctg origene Time Rt Pcr Ggcaaagaggtccaagatgctg Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/PARP9+Human+qPCR+Primer+Pair/pmc07953434__mmc7-210-158-161 Average 90 stars, based on 1 article reviews
time rt pcr ggcaaagaggtccaagatgctg origene - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |