graphpad prism® v.8.00 Search Results


99
STATA Corporation stata 17 statacorp
Stata 17 Statacorp, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+1%2E0/ppr0598942-280-13-15
Average 99 stars, based on 1 article reviews
stata 17 statacorp - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
STATA Corporation version 15 0
Version 15 0, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+15%2E0/pmc10358222-190-6-8
Average 99 stars, based on 1 article reviews
version 15 0 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
STATA Corporation version 12
Version 12, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+12%2E0/pmc07326073-210-16-21
Average 99 stars, based on 1 article reviews
version 12 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
STATA Corporation r version 3 3 3
R Version 3 3 3, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+3%2E0/pmc07758928-111-19-23
Average 99 stars, based on 1 article reviews
r version 3 3 3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
STATA Corporation statistical software release 16
Statistical Software Release 16, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/STATA+16%2E0/pmc07758928-111-24-23
Average 99 stars, based on 1 article reviews
statistical software release 16 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
SYSTAT sigmaplot
Sigmaplot, supplied by SYSTAT, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/SigmaPlot+v14%2E0/pmc08863875-81-13-15
Average 99 stars, based on 1 article reviews
sigmaplot - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Olympus microscope bx61wi
Microscope Bx61wi, supplied by Olympus, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/BX61WI%2FBX51WI+Fixed+Stage+Microscope/10__1007_slash_978___1___4939___0381___8-2847-31-38
Average 99 stars, based on 1 article reviews
microscope bx61wi - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Promega fugene® hd transfection reagent
Fugene® Hd Transfection Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/fugene+hd/pmc07334594__mmc1-46-173-177
Average 90 stars, based on 1 article reviews
fugene® hd transfection reagent - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

97
OriGene 2018 n a ifi44l reverse primer
2018 N A Ifi44l Reverse Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/Primer/pmc07953434__mmc7-210-120-141
Average 97 stars, based on 1 article reviews
2018 n a ifi44l reverse primer - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

90
OriGene time rt pcr ggcaaagaggtccaagatgctg origene
Time Rt Pcr Ggcaaagaggtccaagatgctg Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad+prism%C2%AE+v%2E8%2E00/PARP9+Human+qPCR+Primer+Pair/pmc07953434__mmc7-210-158-161
Average 90 stars, based on 1 article reviews
time rt pcr ggcaaagaggtccaagatgctg origene - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results